Henry:

Your reply is not fair. (For those just joining, see our exchange here http://exmormon.org/phorum/read.php?2,1561468,1561468#msg-1561468 ).

I would be happy to discuss arguments for and against the proposition that religion might very well have a biological/evolutionary basis. I am interested in knowing all about it, whatever the truth may be. However, I would *not* be happy to spend time trying to discuss this with someone whose mind, by his own admission, is already entirely closed on the topic.

That is not something you can justly fault me for. I asked you a simple question: hypothetically, what would convince you were wrong? Your reply was, quote, "nothing".

So, since we already know the answer to my first question, let me ask another: "Why should *anyone* bother trying to have a rational discussion about an empirical question with someone who admits that NO force of evidence or reason will ever be enough to dislodge him from his own already-held view?"

Just give me an answer. I don't need another three paragraphs of snark. Just tell me why anyone should bother discussing anything with someone who leads with, "nothing could ever convince me I am wrong, end of story".

Durn ego

Tal, what would convince you that 2 + potato = invisible? Nothing, obviously, because the question doesn't make sense. Religion is a cultural concept, not a trait, so by definition it could not have evolved. Your question doesn't make sense.

What you need to do is break "religion" down into smaller chunks that could in theory be related to genes. Then we can talk about each of those components and what their survival advantage may have been.

Here's a great Ted Talk on being right.

http://www.ted.com/talks/kathryn_schulz_on_being_wrong#t-167926

Hi Green Potato

To an unintelligible question, no rational answer can be given, certainly. But the question, "what would convince you that religion is adaptive?" - which was the question I put to Henry Bemis - is entirely intelligible, and should be easily answerable by anyone not in thrall to the mind-closing delusions of metaphysical certitude. The answer "nothing" is completely outrageous, and ought to be completely embarrassing for anyone who pretends to have embraced reason after a stint in Mormonism.

You write that "religion is a cultural concept, not a trait, so by definition it could not have evolved." This dismissal ignores the evidence of heritable (i.e., genetic) predisposition to religiosity, which obviously would tend to lead to religious belief, belonging, and behaviour ( http://www.popsci.com/science/article/2013-08/what-twins-reveal-about-god-gene ). (Crucially, religious belief, belonging, and behaviour, as a matter of pure fact, *almost always* motivates/entails higher - *much* higher - reproduction rates, which in turn would produce more people with the trait of religiosity, and so on. See, e.g., https://www.youtube.com/watch?v=IYEyv5a_3LM .)

I suggest that what you and Henry Bemis are doing is a form of question-begging: you are conceptualizing religion in the first place as something which could never have conferred survival advantage, and on that basis, concluding that it did not (and could not have) conferred survival advantage.

This is circular reasoning.



Edited 1 time(s). Last edit at 04/20/2015 02:06PM by Tal Bachman.

Tal, I think that the phrase "religion is adaptive" is too broad for a meaningful discussion. Can you provide an example of a specific religion and its survival advantage? A good example might convince me and Henry that it is worth looking into further.

FYI the popsi.com link isn't working. From what I have read elsewhere, the effect was small and has other possible explanations.

The argument that religions encourage adherents to have more children and therefore pass on more of the genes for religion is a bit naive. As placental mammals our main strategy is having FEWER children but ensuring their survival. A more convincing argument is that religions help ensure the survival of children that parents would otherwise be unable to care for.

I am a huge fan of evolutionary psychology, but I see no way for evolutionary psychology to include religion in any meaningful way. If you break religion down into component traits, the survival advantages of each trait can be found. But doing so leaves religion out of the equation, unless religion as a whole has a survival advantage over and above the component traits. Maybe it could be proven? I honestly don't see how it could.


As yet I haven't seen you define religion? Maybe I missed it? The normal definition of religion is best described as a meme that cares more about its own survival than the survival of the individuals that replicate the meme. Henry and I are not begging the question, we are trying to explain that the question doesn't make sense.

I'm not sure if it'd be correct to say religion came about as a result of evolution, but I do think it's probably natural for our species to be religious.

People often say religion was made by past leaders to control people or unite large populations, but I think these might just be advantages of it. The reason I say this is because there are many lost human tribes out there, groups of humans who haven't had any contact with the outside world whatsoever. Most of them would be astounded to find out that there are 7 billion other humans on the planet! They have no idea. When these people see an aeroplane go across the sky, it often freaks them out, many of the tribes just have no idea what it is.

But my point is, these people have been completely separated from the outside world for a long time, yet even they are religious! Even those people believe in God. And it's not just one or two tribes. Almost every tribe people find it's the same, they have some gods that they worship or they have some spiritual beliefs. This makes me think it's natural for humans to develop religion.

There are many video clips or documentaries on unconcerned human tribes on Youtube.

"Why should *anyone* bother trying to have a rational discussion about an empirical question with someone who admits that NO force of evidence or reason will ever be enough to dislodge him from his own already-held view?"

Why? Because you would be "happy to discuss arguments for and against the proposition that religion might very well have a biological/evolutionary basis" and you are "interested in knowing all about it, whatever the truth may be."

Henry is obviously open to the discussion. So, if you want to have the conversation, the opportunity is available. If it's more important to have the conversation with someone you stand a chance of converting to your thinking, the opportunity may not be available. What's more important - possibly increasing your own understanding our changing someone else's views?

Another reason to have the conversation with Henry (or green potato or ificouldhietokolob and others who seem to know quite a bit about the subject) is that it makes for great reading for at least one person on the board (though this may be outside of the scope of things that make you happy).

From Henry on the prior thread:

"I tell you what . . . provide an account of how it might be possible for religion, or religious faith, to evolve through principles of natural selection, individual or group. You can use your cited authorities as guides. Alternatively, try providing an argument as to why my expressed views in this post are wrong . . ."

Personally, I'd have to decline the offer and make do with asking questions, but if you're willing to bite that off, it should make for the continuation of a great thread.



Edited 1 time(s). Last edit at 04/20/2015 06:40AM by thingsithink.

Yes thingsithink, very much so. Well said.


And in light of your point about this making "great reading" for the rest of us, a fortuitous timing gives RfMers a well-written summary from 3quarksdaily.com of exactly what is being talked about here, and exactly what Tal is proposing:

http://www.3quarksdaily.com/3quarksdaily/2015/04/if-the-dna-molecule-is-the-book-of-life-its-a-very-strange-book-indeed.html

Interested readers like me who know the basics of the discussion but nonetheless trip over the differences between phenotype and genotype, heredity and development, mRNA and tRNA, guanine & adenine & thymine & cytosine and have only a nascent understanding of Waddington's epigenetic landscape, etc, will find it all laid out in today's blog-post by Yohan J. John. It's all there. Now's the time to catch up on all this fascinating stuff. If all these terms make your eyes glaze-over, John's piece will help clear the eyes and make the complex less intimidating. Recovery means many things, including allowing ourselves to be curious and to go past our comfort zones.


For my part, I'm interested not so much in the ways and means of how 'genetic information' gets past on and 'codes' for the development of an organism, a process which Tal holds the possibility that our mormon religiosity was somehow 'coded' for before we were born. Definitely interesting stuff but not in itself exactly my cup of tea.

What fascinates me are the uses and abuses and limits of the metaphors employed to describe the ways and means of this 'process'. What are the limits of the usual metaphors of 'book', 'library' and 'machine'? Would not 'origami' be a better metaphor for what the DNA molecule does?

Here's how the article concludes:

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Over the past few months I have tried to look at information from a variety of angles as I worked my way towards the concept of genetic information —a concept that seems to be creaking under the weight of empirical reality these days. One thing I rarely come across when I read about codes in biology is the idea that the real codes used by humans are typically arbitrary and ad hoc. There is no necessary physical connection between the word 'tea' and the beverage. If someone made up a word and explained to me that it meant tea, I would have no problem adding it to my lexicon. Any symbol can be used to stand for any other object, or person, or concept, or percept. Inheritance may involve discrete traits, and the nucleotides that make up the DNA sequence may seem very much like letters, but unlike human codes, nature's symbols do not seem to be ad hoc. Could we somehow coax a ribosome to turn, say, the symbol-string 'AGGTACCATCATGATGATGAT' into an arbitrary protein of our choice? Could we even invent an artificial system that would do this? I don't think so, because proteins are more than just the sum of the amino acids that make up their chain. Proteins are three dimension physical objects that can fold up in several ways. This folding depends on factors other than the amino acids, such as the temperature, the pH, the concentration of salts, and various other physical and chemical factors that are rarely given the privileged title of biological 'information'.

What is true of the protein molecule is also true of the entire genome. It's three dimensional structure has a powerful effect on which of its stretches of DNA are allowed to be transcribed. And this structure may well depend on existing levels of gene expression, as well as 'contextual' factors inside as well as outside the cell. There is no denying that some aspects of the genome resemble long strings of abstract symbols. But perhaps this is only a resemblance. For understanding transmission genetics, perhaps this resemblance provided the necessary spark for the researchers' imaginations. But perhaps developmental genetics, and genomics, and epigenetics, and biology more generally, will be better served by Waddington's more grounded metaphor: marbles rolling down a hilly landscape. The marbles are not words to be translated, but real physical objects whose trajectories are influenced by all the processes that are currently ongoing — from the texture of the surface it is rolling on to the subtle movement of the air — as well as the tracks left by marbles that have been down those paths before.

Perhaps abstract, symbolic and informational notions can only take us so far, after which nature invites us to reacquaint ourselves with those of its facets that are irreducibly concrete and physical.
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

When we talk about science we are not only limited by our collective knowledge thus far but also by the language we use to describe that collective knowledge. We must keep in mind that reality itself is always beyond our ability to describe it and thus beyond our ability to know it ultimately.

But we may experience it.

Human

For interested readers here is a very good if controversial and much maligned article on the problem of "gene expression" which states it's time to give up on Dawkins's metaphor of the 'selfish gene':

http://aeon.co/magazine/science/why-its-time-to-lay-the-selfish-gene-to-rest/

The article deals with the 'phase change' between gentle grasshoppers and devouring locusts. Different animals with different genes? Nope. A Dr. Jekyll and Mr. Hyde example of the same genes giving a different expression. This is a point that complicates (to say the least) the general idea that there is a gene(s) for this and a gene(s) for that.

Response to Human: (I have noticed that sometimes responses are physically misplaced in a post)

COMMENT: There is no such thing as "codes" in nature, genetic or otherwise. There are only causal processes and functional mechanisms. Calling DNA sequencing "code" suggests that nature "represents" protein structures by DNA sequences. That somehow this code is deciphered by nature, or "the mind of God." Frances Crick suggested this very thing when comparing DNA base designations (AGCT) to the English alphabet. This suggestion was an attempt to simply the complex transcription process by a so-called "sequencing hypothesis." Note that this is not presented as just a metaphor, it is an assumption that symbolic coding is actually involved in the process.

Since codes always involve mind and intentionality, we might ask, "Who set up this code?" "Who decided that a certain DNA sequence would "represent" some protein, trait or function?" Such questions play into the hands of intelligent designers. (See e.g. Stephen Meyer, Signature of the Cell.)

The DNA base pairs, AGCT are not representational. They do not "stand" for anything. They are not "symbols." They are molecular structures with certain causal properties within a given environment. What needs to be explained is how individual molecular components--not just DNA, but epigenetic components as well--come together to form an awesomely complex biological system, such as a human being. Given epigenetics, and principles of evolutionary development, that magnificent complexity is overwhelming. The information content of such systems is incredible, to say the least. And, again, codes have nothing to do with it.

Thus, your point, exactly: "Perhaps abstract, symbolic and informational notions can only take us so far, after which nature invites us to reacquaint ourselves with those of its facets that are irreducibly concrete and physical."

But then we are left with the physical system as a whole, which cannot be explained by simplistic appeal to its molecular subparts and their functional properties. Moreover, it creates heavy lifting for evolutionary biology. The whole thing shouts for further explanation. Which is why Stuart Kauffman, and others, insist that "complexity theory," or some other natural process, must play a role.

But this is another post, I suppose.

Thank you for making my point shorter and clearer, Henry.

I remember awhile ago you briefly discussed your issues with information theory and its intersection with neurobiology so you might like this, the part one companion to the part three I posted above:

http://www.3quarksdaily.com/3quarksdaily/2015/02/information-the-measure-of-all-things-part-i-communication-codes-and-computation.html

I am not a little astounded how many times I read scientific articles that really do seem to take their metaphors literally. For example, as you say, AGCT are actual, physical *things* and not symbols. The AI folks holding out for a future download of their minds to some kind of hard drive really need to understand that very simple point.



Henry Bemis Wrote:
-------------------------------------------------------
Moreover, it creates heavy
> lifting for evolutionary biology. The whole thing
> shouts for further explanation. Which is why
> Stuart Kauffman, and others, insist that
> "complexity theory," or some other natural
> process, must play a role.


Exactly, and let me just add a 'very' to that "creates *very* heavy lifting for evolutionary biology."


I think geneticists have yet to definitely link gene sequences to fairly simple behaviours let alone extremely complex groups of behaviours that go into what we might call 'religiosity'. And that completely leaves alone the polysemic nature of the term in the first place.

What's needed is a critical examination into how much money has been invested into genetics with all the pre-genome hope that genes would signify big time. It's notoriously under-reported exactly why we were able to map out the human genome more quickly than was hypothesized. There are more than one reason, but primary the reason is because scientists expected way way more genes to the human than otherwise it turned out to be (again, less than a tomato). But given the investment, and the reputations of some very famous and powerful celebrity scientists, we're still talking about things eve-deco etc. And that is despite some pretty pointed, factual and even hilarious take-downs (one thing I'm thinking of is Rebecca Watson at Skepticon a few years ago). Alas.

Yes, genes ---> proteins; but how those proteins make one introverted and another extraverted for example is an entirely different thing, ESPECIALLY since we know so little about how the brain *as it is today* works to create/manifest personality traits. And no, knowing what region lights up when someone remembers their childhood is knowing not a hell of a lot!

Yes yes, I'm being too dismissive. I learn to temper this tendency with nuance as I read your further, more tempered responses to other posters.

Cheers to you my friend,

Human

I know this is off topic, but your song just came on my Pandora, Tal. I had a testimony of the awesomeness of "she's so high", years before the Mormons dug their claws into me.

Be well!

If someone asked me what would convince me that water is not made up of two atoms of hydrogen and one atom of oxygen, I would reply "nothing." Because massive evidence clearly and unambiguously demonstrates that it is. It's a determined fact.

There are subtleties *in* that determined fact -- what kind of molecular bonding is involved? Do the sub-atomic particles that make up hydrogen and oxygen atoms influence how water molecules form? Could there be a type of "water"-like molecule made up of some other atoms? Etc., etc. etc. Those merit discussion and perhaps even speculation. The fact itself merits discussion (though it remains a fact). If for no other reason than to explain how we know it's a fact.

There is hypothesized speculation that "religion" could be subject to natural selection. There is little to no evidence that it actually *is,* and the evidence that it's a social construct NOT subject to natural selection (though some human "instincts" that are subject to natural selection have been exploited by the social constructs to create religion appears likely) is extensive. That's the state of things, but that's not the state of things that Tal's posts have taken into account -- which is why there was criticism of them.

I'm currently re-reading "The Ancestor's Tale" by Richard Dawkins. A salient point he points out in the chapter I just read is that even actual genotype changes over geologically "short" periods (and the known 6,000 year history of human religion certainly qualifies as geologically short) wander all over the place, and that noise can appear to "swamp" longer-term trends that lead to genotype changes that stick and persevere. So even IF religious belief were subject to natural selection (and there's little to no evidence it is), the short time it's known to have been around could just be "noise," instead of any kind of naturally-selected long-term change with sticking power. The huge variety of religious belief in the short known period of it argues for that, as does the significant (and growing) percentage of humans without religious belief. Those things argue strongly for religion being a social structure, not a part of the human genotype that's subject to natural selection.

ThingsIThink: Read Henry's post. You mistake him. What he is "obviously open to" is delivering yet another Bruce R. McConkie-style triumphal monologue about how he has lighted upon "the one true answer" to a difficult question, such that *no evidence or reason* could ever in principle convince him he was wrong. But to my mind, that is a very different thing than "being open" to "having a discussion".

Potato: Regarding your doubts about the propagation of religiosity via fecundity, the data are very clear. They are discussed at length in Eric Kaufmann's book, "Shall the Religious Inherit the Earth?", and summarized in the speech I linked to: https://www.youtube.com/watch?v=IYEyv5a_3LM. (Listen to Kaufmann's discussion of the ultra-orthodox Israeli Jew community as a case study).

Regarding the other article, the link works for me, so not sure what the problem might be. Maybe try a different browser? Here it is again: http://www.popsci.com/science/article/2013-08/what-twins-reveal-about-god-gene

Lastly, one definition of religion adequate to our purposes here comes from Durkheim:

"A religion is a unified system of beliefs and practices relative to sacred things, that is to say, things set apart and forbidden - beliefs and practices which unite into one single moral community called a Church, all those who adhere to them".

By the way, I am not getting something here. At all. Maybe someone can help me.

To my mind, when we look at this question, we could very well start here:

Religious populations in most cases reproduce at higher rates than non-religious populations. Over time, this translates into large demographic shifts in favour of religious populations. This is actually a fact, as is the fact that the more *conservative* the religious group is, the more fecund they tend to be.

What I'm not getting here is: how can those facts be reconciled with the notion that religion, and religiosity, lies entirely outside the realm of biology/biological evolution?

Tal Bachman Wrote:
-------------------------------------------------------
> What I'm not getting here is: how can those facts
> be reconciled with the notion that religion, and
> religiosity, lies entirely outside the realm of
> biology/biological evolution?

Because the fact of CHOOSING higher reproductive rates does not in any way indicate that the system of dogma that encourages that choice is subject to natural selection in any way, shape, or form -- or that the system of dogma that encourages higher reproduction rates is in any way derived from DNA that is subject to natural selection.

You're espousing "social Darwinism," and trying to insist it's biological evolution. That's what's wrong.

From your other post:

" What he is "obviously open to" is delivering yet another Bruce R. McConkie-style triumphal monologue about how he has lighted upon "the one true answer" to a difficult question, such that *no evidence or reason* could ever in principle convince him he was wrong."

In your original post, you said that anyone who didn't accept what you were calling evidence of religion being biological in origin and subject to natural selection some choice, insulting names...is that different? :)

1. You are confusing reproductive success with long term survival. Having lots of babies doesn't help next time there is a famine. Having more babies doesn't help if it increases the chances of the mother dying and being unable to care for ALL of the children. There are lots of ways that more babies can lead to a lower chance of survival.

2. You are confusing individual reproduction with increasing the frequency of a gene in the gene pool. If a group of individuals breed more successfully than another group, it only makes a difference to the gene pool if those individuals have a gene that those outside the group do not have. Religions are generally easily converted to, and even when they are not, eg with Judaism, there is enough interbreeding to make the group genetically no different to the general population. Increasing the frequency of ALL genes makes no difference to the gene pool.

The Invisible Green Potato Wrote:
-------------------------------------------------------
> 1. You are confusing reproductive success with
> long term survival.

Yep. Natural selection operates mostly on *fitness* -- how well groups of similar-genetically populations "fit" into the environment. Swamping a population won't "succeed" long-term if the swamping individuals aren't any more "fit."

http://exmormon.org/phorum/read.php?2,1565264,1565264#msg-1565264



Edited 1 time(s). Last edit at 04/20/2015 08:28PM by steve benson.

Kudos to Tal and Steve. I found Tal's question provocative, and Steve's response evocative. At length even.

Thank you, Steve.

Potato, I appreciate your patient and amiable tone.

Yes, I can see that in certain situations, the more people, the harder group survival might be. But I think we are talking here about a much broader and more influential phenomenon.

On your second point:

Religions indeed can be converted to, but it is an empirical question whether religions grow mostly from being passed on from one generation to the next, that is, from parent to child (or *vertically*, as it were), or through conversion (*horizontally*, as it were). Numerous studies have provided the answer to this question: religions grow mostly vertically. (Mass conversions do occur, but are historically quite rare).

The next question I think is whether "religiosity" as a personality trait is heritable. In fact it is (again, for starters, see, e.g., http://www.popsci.com/science/article/2013-08/what-twins-reveal-about-god-gene ). Given that it is also a fact that the more religious a population is, the more they tend to reproduce (again, see Kaufmann's "Shall the Religious Inherit the Earth?"), it becomes easy to see how religiosity, that is, a genetic predisposition to religious belief, behaviour, and belonging, could propagate itself in our species. The universality of religious belief, behaviour and belonging around the world seems to testify of this commonsense supposition.

I guess it might still be objected that religiosity, though heritable, and in fact inherited by most humans, might not necessarily have conferred any survival advantage. Maybe it was just along for a ride.

Charles Darwin addresses this question in "The Descent of Man". There, he sketches out how religiosity could have been favoured by evolution.

The first step, he says, is to see that a social group can function as a single unit. The second is to see that each group (unit) can potentially compete with other groups/units. The third is to see that a tribe with certain traits and behaviours (he lists things like courage, sympathy, fidelity, cooperativeness, etc.) "would succeed better and conquer the other". He goes on to say that "selfish and contentious people will not cohere, and without coherence nothing can be effected. A tribe rich in the above qualities would spread and be victorious over other tribes".

After discussing the free rider problem, Darwin concludes:

"Ultimately our moral sense or conscience becomes a highly complex sentiment - originating in the social instincts, largely guided by the approbation of our fellow-men, ruled by reason, self-interest, and in later times, *by religious feelings*, and confirmed by instruction and habit".

(Note that I am not saying here that we should believe that multi-selection occurs only because Darwin says it did; I'm only providing a summary of Darwin's views, which - after three decades of scorn - are now being confirmed, or re-confirmed, by a growing body of research).

More later.

Tal Bachman Wrote:
-------------------------------------------------------
> Yes, I can see that in certain situations, the
> more people, the harder group survival might be.
> But I think we are talking here about a much
> broader and more influential phenomenon.

I think it is safe to assume that for most of history, populations have been at their environmental limit. Thus the last few hundred years, with unprecedented population growth due to technological advances are an exception. Evolution therefore needs to be weighted towards a situation of overpopulation, when additional children are not an advantage.

> On your second point:
>
> Religions indeed can be converted to, but it is an
> empirical question whether religions grow mostly
> from being passed on from one generation to the
> next, that is, from parent to child (or
> *vertically*, as it were), or through conversion
> (*horizontally*, as it were). Numerous studies
> have provided the answer to this question:
> religions grow mostly vertically. (Mass
> conversions do occur, but are historically quite
> rare).

It is not a question of whether religions grow mostly from being passed on through generations. It is a question of whether sufficient genetic diversity is obtained through occasional conversions to result in populations within the religion and outside the religion that are essentially the same.

> The next question I think is whether "religiosity"
> as a personality trait is heritable. In fact it is
> (again, for starters, see, e.g.,
> http://www.popsci.com/science/article/2013-08/what
> -twins-reveal-about-god-gene ).

What makes me very uncomfortable about reading too much into the twins studies is that "religiosity" is not well defined, and it is a compound of other more elementary traits. Those more elementary traits are themselves subjective. The end result is too fluffy to be reliable.

> Given that it is
> also a fact that the more religious a population
> is, the more they tend to reproduce (again, see
> Kaufmann's "Shall the Religious Inherit the
> Earth?"), it becomes easy to see how religiosity,
> that is, a genetic predisposition to religious
> belief, behaviour, and belonging, could propagate
> itself in our species.

Indeed, but does it propagate itself in our species as a virus or as part of our genome?

> The universality of
> religious belief, behaviour and belonging around
> the world seems to testify of this commonsense
> supposition.

Tal, your definition of religion was:

"A religion is a unified system of beliefs and practices relative to sacred things, that is to say, things set apart and forbidden - beliefs and practices which unite into one single moral community called a Church, all those who adhere to them".

According to your definition, most indigenous populations do not practice religion since they don't have churches. That is why a very carefully worded definition of religion is required to have a meaningful discussion. You can't just change the definition whenever it supports your hypothesis.

> I guess it might still be objected that
> religiosity, though heritable, and in fact
> inherited by most humans, might not necessarily
> have conferred any survival advantage. Maybe it
> was just along for a ride.

Indeed, and it is much more likely to be along for the ride if religiosity is actually a compound of elementary traits, each of which independently gives an survival advantage.


Re Charles Darwin: don't believe everything that Charles Darwin said. He was years ahead of his time (DNA hadn't even been discovered yet) but much of what he said, with the benefit of hindsight, was educated guesses or speculation. For example, he came up with the laughable idea that whales descended from bears, LOL. We all know that whales really descended from a wolf-like creature ;)

I would love to have a discussion of whether group selection is really a "thing", preferably in a new thread. I used to like the idea of group selection, then I read Dawkins and threw the idea in the bin. I would be surprised if there was any valid examples of real-world group selection.

Upon further reflection, I am willing to concede that there is a link between genes and religion.

My working hypothesis is that "religion" is a type of meme that infects humans. It is passed from human to human via cultural and social influences. It is often passed from parents to children via "indoctrination" from a young age. Genetic factors influence personality traits. Personality traits affect susceptibility to religious infection. "Religiousness" is a measure of personality traits that make a person susceptible to religious infection. The twins studies are consistent with my working hypothesis.

Tal, I am not sure what your hypothesis is. Do you believe that there are genes for "religion"? Do you think the twins studies prove your hypothesis?

An interesting, albeit unethical experiment would be to raise a sample of children in isolation. If some of the children develop "religion" on their own then it could be that there is a gene for religion. Or it could be that isolation drives people to insanity, and insanity drives creation of religion ;) Either way, a gene for religion should produce a religion in the absence of an existing religion.

I missed most of this as it developed.

Fascinating post.

But Tal, I simply can't get around this line Henry addressed to you:

"If you want to have credibility here, provide an account of how it might be possible for religion, or religious faith, to evolve through principles of natural selection, individual or group."

I can't see anywhere in the threads where you propose a causal account, let alone a mechanism, of how "religion" or "religiosity" can "evolve" or be selected for.

And instead of engaging the discussion at that level, you are stalled out on Henry saying that "nothing" could make him change his mind. That was most likely hyperbole, Tal, and I would just get over it since Henry seems to be a reasonable and intelligent person. This last iteration of your post feels like you are more interested in winning a debate than seeking understanding.

But of course any contrary evidence might make me change my mind...

Generation - Thanks for contributing.

You asked for a causal account, but I am not clear on why Darwin's proposal (which I summarized above) does not qualify as a plausible causal account. Can you explain what I might be missing, or what more you would need for an adequate, plausible causal account?

As for Henry, there is no reason to believe his comments were hyperbolic; and indeed, given his past posts, every reason to believe he was being straight up. While bright, he is relentlessly pontifical and dogmatic, and his consuming infatuation with his own views seems to disallow him from rationally appraising or re-appraising them, even in cases where evidence clearly contradicts them (as was demonstrated in a former discussion of ours on Karl Popper).

In any case, when a guy shows up and announces that "nothing" could, in principle, ever change his mind about something, I just don't have the stomach to engage. I've already gone through that kind of thing with Daniel Peterson and other Mormon dogmatists. The disdain-laden lectures are grating, the invincible close-mindedness is grating, and you just can't trust anyone who leads with "nothing could ever change my mind" to conscientiously weigh (new) evidence which might help us get at the truth. I want to go over the evidence with curious, bright people like you and Potato (so I can figure out what I'm missing, or figure out if I might be right), not deal with Henry Bemis's own ex-Mormon version of "when the prophet speaks, the thinking's been done, so shut up while I announce the truth".

Potato - Great thoughts but I have to run at the moment. Just quickly, on the Durkheim quote, I believe he is using the term "church" metynomyically, that is, to refer to any community of believers.

Thanks for the comments. Talk to you soon.

Talk to you soon!

Tal:

I honestly do not know what I did, or said, to offend you; or warrant this diatribe of insults, except to disagree with you. All my comments contain arguments and explanations which you can agree with or disagree with. Virtually everyone that responded to your prior post, and this post, have disagreed with your thesis. Many have acknowledged the validity of the points I raised, some that have pointedly disagreed with me on other posts. Yet, for some reason, they are deemed patient and trustworthy, and I am engaging in "close-minded," "disdain-laden," lectures.

Moreover, I have bent over backwards in many posts to respond in detail to your theories and inquiries, some of which were directed expressly to me. So, apparently you value my opinion, but just want it sugar-coated, or presented in a more humble and tentative manner. I am not very good at that, particularly when the conclusion appears clear and straightforward to me.

If I may say so, what you need to "trust" is not me, Potato, Kolob, or anyone else. You need to learn to read arguments and judge them on their merits, without worrying about whether or not you are comfortable with the person or presentation. Frankly, I doubt that anyone on this Board likes my presentation, particularly when the point I am trying to make is adverse to their own way of thinking. Should I then stop posting?

__________________________________________

TB "You asked for a causal account, but I am not clear on why Darwin's proposal (which I summarized above) does not qualify as a plausible causal account. Can you explain what I might be missing, or what more you would need for an adequate, plausible causal account?"

COMMENT: A causal account, or as they say, a "just-so story" in evolutionary theory is a proposal as to how a particular trait may have arisen from biological processes, and how that trait might have been favored in terms of reproduction and survival, such as to provide an evolutionary advantage. I did not suggest you attempt this to press you or embarrass you. Sometimes, such an exercise creates understanding and a realization that the thesis proposed is untenable.

If I have pontificated in this response, I apologize. I do appreciate your posts, and your sincere desire for learning, and am sorry if I come across as close-minded and arrogant. I have learned from you in the past, and would like to continue to do so in the future. But I doubt I can change my style. It just comes out that way.

HB

Henry - I appreciate your conciliatory tone. I admit it's helped me calm down...

What has triggered me here is your announcement that "nothing" would change your mind. How can that possibly be, if you don't have a closed mind? And if you have a closed mind, how in the world can I take seriously your perspectives on this stuff? All I want to know is what sort of evidence would convince you that the universality of religion has a (partial at least) evolutionary explanation...seriously, how can that be hard to answer?

O.K. My "nothing" response was admittedly somewhat rhetorical. But when one looks at what would be required to establish an evolutionary component to religion, or religious faith, it just seems so preposterous that "nothing" comes very close to actuality with me, and most others . Let me explain:

First, let's get clear as to what we are trying to show. We are trying to provide a "just-so" story as to how it might be possible for religious beliefs, and by extension religious institutions (i.e. religion), to be favored by Darwinian principles of natural selection. And, for the sake of argument, let's add, favored, "in whole or in part." In short, does evolutionary biology (Darwinism) have any relationship to religion. Notice that I have formulated the question in its broadest terms in order to accommodate your proposed thesis.

Now, the very first thing we need to understand is that in our inquiry the propensity toward religious belief is deemed a biological "trait" to be explained. In biological terms it is a phenotype, but instead of being just a physical trait, like red hair, it is a psychological trait, i.e. a propensity to have certain beliefs. Next, we need a link between such religious beliefs and biology, such that we are able to differentiate biologically, at least in principle, those who have religious beliefs from those that do not. Ideally, we would look for a "gene" or postulate some genetic component, that again at least in principle, we can say, "That person has it, and that person does not have it." Note, what we cannot do is start off with a bare assumption that this biological component must exist simply by the fact that some people are religious and some are not. Such an assumption would beg the question.

Now, we can ask ourselves, is it reasonable that there be such a genetic component to religious beliefs? Right away we get a resounding NO. This is NOT because our beliefs do not have a physical, biological underpinning. We can still be physicalists about beliefs, but for evolution we need more, as stated above. So, let's assume we are physicalists. How then should we explain beliefs; as genetic endowments, or as a product of brain function and the environment. Well, neuroscience tells us that our psychological states are the products of our brain states. Thus, a given belief is correlated not with a gene, but with the functional properties of a neural network, as triggered from environmental input (i.e. what our parents taught us) The brain is known for its plasticity. Thus, both our brains and our beliefs can change over time, presumably as a result of environmental input. (e.g. exposure to the writings of Charles Darwin) So, it appears that fundamentally, our beliefs occur on the level of neurology, not on the level of molecular biology.

But, wait, our brains develop from genetic instructions. Isn't it possible that some such genetic instructions favor brains that develop with a propensity toward religious belief? In general, No. Brain development does not work that way. It is structural development, not belief development. Beliefs form on top of such structures. Now, such structures do include some functional propensities; like the propensity for language learning, or the propensity to form beliefs in general. But to suggest that brain structure encompasses specific beliefs, requires far too much genetic work than is available from known genetic mechanisms. Moreover, it would not explain how such genetic mechanisms change over the life of a single person. Remember, genes, or genetic mechanisms, must have stability to be passed on. On the other hand, absent well-defined and stable religious oriented mechanisms, it would be difficult to further explain how such mechanisms are passed on to subsequent generations.

But that is not the real problem. You still need to trace the specific brain developmental component to the propensity for religious belief. There is a huge gap to be filled. Then, as indicated above, you have to show that there is a fine distinction between one developmental path, say the believer path, and an opposing path, the non-believer path. Otherwise, natural selection cannot take hold on a biological level.

Suppose, now you get this far. We still have not addressed the issue of selection. You must show that religious faith is favored such that those with the biological belief component are favored over evolutionary time, creating more believers at the expense of a reduction in non-believers. (Absent other factors, of course) You have suggested some possibilities along these lines, but they are very weak speculations. Moreover, if you need group selection to get this going, the task is next to impossible just by the mathematics of group selection. As Potato suggested, an argument can be made that group selection is not only rare in nature, but nonexistent.

But, again, if you think group selection is operable, you need to show all of the above, plus that isolated religious groups--where religious belief of itself did not have a reproductive or survival advantage on an individual level within the group (think of altruism)--created a favorable group selection environment because of the effect that religious beliefs had on the survival of the group. Moreover, you must show that a competitive environment with non-religious groups existed sometime in the past, such that religious belief, because favored on the group level, created a survival advantage for both religious groups and individuals within the groups. Frankly, this is just not possible. That is classic group selection. Any other form of "group selection" is not Darwinian, but some sort of vague intuitive notion.

So, hopefully, I have explained my summary comment of "nothing." There is just way too much to try to show here, and most of it is contrary to what we know and understand about biology, neuroscience, psychology, and the social sciences.

People who insist that religious faith, or religion has an evolutionary component are generally people who are dismissive of religion having any substantive validity. ("There is no God, such beliefs are just products of evolution!") Note, however, that people like Richard Dawkins who are both biologists and vocally anti-religion, do not take this step. They argue against religion from the unreasonableness of the beliefs themselves, not by stating that such beliefs are undermined because they can be explained by evolution. By the way, no one is more anti group selection than Dawkins.

I hope this helps.

So, Are we good?

Henry: That was great. Yes, we are good.

My curiosity about these things is such that sometimes, its pulse grows to a furious pace and almost drives me nuts, and all I can think about is figuring out the answer. So your post here has helped me get clarity on just what specifically needs to be shown here. I appreciate it.

This thread will be shut down soon, so maybe a new thread is in order in the next day or two. On that new thread, I'll see if I can find ways in which the evolutionary hypothesis can rise to meet your burden of proof.

Thanks again.

I'm still having trouble understanding what is meant by the word "religion." Do we really mean something besides "imagination plus a narrative?"

For example, humans allow themselves to be controlled by a dominant person under some circumstances, a big-man, chief, or king. With human imagination is it such a stretch for people to imagine a supernatural big-man or chief ruling over, or being "Lord" over the human chief? The human chief is considered political or social organization, but the supernatural chief is "religion." But is there really any substantial difference between the two? Both require imagination and a narrative to sustain the chief's legitimacy, his authority; but, for all intents and purposes, the two chiefs, and their relationship to the commoner--existing only in the commoner's mind, being too distant to actually interact one-on-one--are exactly the same.

Similarly, isn't a "belief" in life after death nothing more than an awareness of mortality combined with the capacity to imagine or speculate about what might happen "after" death, in the same way someone can imagine what they'll do tomorrow, after they wake up from the period of unconsciousness known as sleep? The distinction between "religion" and "future plans" is simply the distinction between sleep and death, which humans can analogize.

In other words, as Henry Bemis pointed out, religion is a content of thought which we class as "religion" as opposed to content of thought we call politics or food selection or something else. Yet these thoughts are maleable and constantly reinforce or subvert each other because they are produced as functions of a neural network. The thoughts are not the structural components of the network itself.